| TRF(1) | User Commands | TRF(1) |
trf - locate and display tandem repeats in DNA sequences
trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]
Where: (all weights, penalties, and scores are positive)
See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html
Note the sequence file should be in FASTA format:
>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg
Copyright © 1999-2020 Gary Benson
This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.
| June 2020 | trf 4.09.1 |